pBbE5a-Opto-Cre-Vvd
(Plasmid
#134404)
-
PurposeLight-inducible Cre recombinase split with Vivid photodimers for bacterial expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134404 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBbE5a
- Backbone size w/o insert (bp) 3709
- Total vector size (bp) 5720
-
Vector typeBacterial Expression, Cre/Lox, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)MG1655
-
Growth instructionsWhen transformed with Cre reporter, store in the dark.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOpto-Cre-Vvd
-
Alt namenCre-Vvd/Vvd-cCre
-
Insert Size (bp)2011
- Promoter lacUV5
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggaattgtgagcggataacaatttc
- 3′ sequencing primer cgttttatttgatgcctggagatcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/786533v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbE5a-Opto-Cre-Vvd was a gift from Mary Dunlop (Addgene plasmid # 134404 ; http://n2t.net/addgene:134404 ; RRID:Addgene_134404) -
For your References section:
Light-Inducible Recombinases for Bacterial Optogenetics. Sheets MB, Wong WW, Dunlop MJ. ACS Synth Biol. 2020 Feb 21;9(2):227-235. doi: 10.1021/acssynbio.9b00395. Epub 2020 Jan 21. 10.1021/acssynbio.9b00395 PubMed 31961670