-
Purposesequence optimized N‐acetyl lysyl‐tRNA synthetase with cognate tRNA for genetic code expansion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137976 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEVOL
- Total vector size (bp) 5651
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAckRS and pylTcua
-
SpeciesMethanosarcina mazei
-
Insert Size (bp)1365
- Promoter araBAD
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tttcagatgggttctggctgcacccgtg
- 3′ sequencing primer aaagttcagcatagtgaactcttcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEVOL-AckRS was a gift from Wenshe Liu (Addgene plasmid # 137976 ; http://n2t.net/addgene:137976 ; RRID:Addgene_137976) -
For your References section:
A Click Chemistry Approach Reveals the Chromatin-Dependent Histone H3K36 Deacylase Nature of SIRT7. Wang WW, Angulo-Ibanez M, Lyu J, Kurra Y, Tong Z, Wu B, Zhang L, Sharma V, Zhou J, Lin H, Gao YQ, Li W, Chua KF, Liu WR. J Am Chem Soc. 2019 Feb 13;141(6):2462-2473. doi: 10.1021/jacs.8b12083. Epub 2019 Feb 4. 10.1021/jacs.8b12083 PubMed 30653310