-
PurposetRNA synthetase/tRNA pair for the in vivo incorporation of a photocrosslinker, p-benzoyl-l-phenylalanine into proteins in E coli in response to the amber codon, TAG.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep15A
- Backbone size w/o insert (bp) 5000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAny strain for growth, 37 oC, LB/2XYT media
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameM.j. p-benzoylphenylalanine RS (2 copies +tRNA)
-
Alt namepEVOL-pBpF
-
SpeciesM.jannaschii
-
Insert Size (bp)1000
-
MutationY32G, E107P, D158T, I159S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer ATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTT (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEVOL-pBpF was a gift from Peter Schultz (Addgene plasmid # 31190 ; http://n2t.net/addgene:31190 ; RRID:Addgene_31190) -
For your References section:
Addition of a photocrosslinking amino acid to the genetic code of Escherichiacoli. Chin JW, Martin AB, King DS, Wang L, Schultz PG. Proc Natl Acad Sci U S A. 2002 Aug 20;99(17):11020-4. Epub 2002 Aug 1. 10.1073/pnas.172226299 PubMed 12154230