-
Purpose(Empty Backbone) 3rd generation, Inducible lentiviral expression, TRE-gateway; PGK-rtTA-2A-puro
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41393 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Cloning Grade DNA | 41393-DNA.cg | 2 µg of cloning grade DNA in Tris buffer | 1 | $105 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCW57.1
- Backbone size (bp) 9354
-
Vector typeMammalian Expression, Lentiviral ; Gateway Destination vector, Doxycycline inducible
- Promoter TRE promoter, Tet ON
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsNote that this plasmid grows slowly. Liquid cultures may need to be incubated up to two days for substantial growth.
-
Copy numberUnknown
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer LNCX
- 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG) (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid expresses rtTA-VP16-2A-puro from the PGK promoter, so it can be used as an 'all-in-one' dox on system.
Alternate plasid names:
pLIX_401
TRE-gateway; PGK-rtTA-2A-puro
Information for Cloning Grade DNA (Catalog # 41393-DNA.cg) ( Back to top)
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $105 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57.1 was a gift from David Root (Addgene plasmid # 41393 ; http://n2t.net/addgene:41393 ; RRID:Addgene_41393)