EMM71T
(Plasmid
#49044)
-
Purpose(Empty Backbone) Backbone contains SHD/T 0.5 Domain TALE N-terminal TALE C-terminus, LSD1: Isoform 2
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneunknown
-
Backbone manufacturerJoung Lab
- Backbone size (bp) 8550
-
Modifications to backboneReplaced p65 with LSD1
-
Vector typeMammalian Expression ; TALE LSD1 Expression Vector
- Promoter EF1 alpha
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGACGCAGTTCGGGATGAG
- 3′ sequencing primer TTCGGGAATACGGCGATTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EMM71T was a gift from Bradley Bernstein & Eric Mendenhall (Addgene plasmid # 49044 ; http://n2t.net/addgene:49044 ; RRID:Addgene_49044) -
For your References section:
Locus-specific editing of histone modifications at endogenous enhancers. Mendenhall EM, Williamson KE, Reyon D, Zou JY, Ram O, Joung JK, Bernstein BE. Nat Biotechnol. 2013 Sep 8. doi: 10.1038/nbt.2701. 10.1038/nbt.2701 PubMed 24013198