-
PurposeRetroviral vector contains CAG promoter , CMV enhancer and a large synthetic intron that used to allow the ubiquitous expression of GFP-fused Cre recombinase
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCAG-GFP
-
Backbone manufacturerGage lab (Addgene plasmid# 16664)
- Backbone size w/o insert (bp) 6817
- Total vector size (bp) 8681
-
Modifications to backbonevector backbone based on the pCL system by Naviaux et al.,J. Virol. 70, 5701–5705 (1996).
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP/Cre
-
Alt nameGFP-fused Cre recombinase
-
SpeciesSynthetic
-
Insert Size (bp)1870
-
GenBank ID
- Promoter CAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTC GGC AAC GTG CTG GTT GTT
- 3′ sequencing primer CAACATAGTTAAGAATACCAGTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-GFP/cre was a gift from Fred Gage (Addgene plasmid # 49054 ; http://n2t.net/addgene:49054 ; RRID:Addgene_49054) -
For your References section:
Retrovirus-mediated single-cell gene knockout technique in adult newborn neurons in vivo. Tashiro A, Zhao C, Gage FH. Nat Protoc. 2006;1(6):3049-55. 10.1038/nprot.2006.473 PubMed 17406567