-
PurposeGi-coupled hM4D DREADD fused with mCherry under the control of CaMKIIa promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50477 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
AAV2 | 50477-AAV2 | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | $405 | ||
AAV5 | 50477-AAV5 | Virus (100 µL at titer ≥ 3×10¹² vg/mL) and Plasmid. | $405 | ||
AAV8 | 50477-AAV8 | Virus (100 µL at titer ≥ 2×10¹² vg/mL) and Plasmid. | $405 | ||
AAV9 | 50477-AAV9 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $405 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 7553
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehM4D(Gi)-mCherry
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2169
-
MutationSee supplemental documents for DREADD mutations
-
Entrez GeneCHRM4 (a.k.a. HM4, M4R)
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sal I (not destroyed)
- 3′ cloning site EcoR I (not destroyed)
- 5′ sequencing primer ATGCTGACGAAGGCTCGCGA
- 3′ sequencing primer GCATTAAAGCAGCGTATCCACATAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
Information for AAV2 (Catalog # 50477-AAV2) ( Back to top)
Purpose
Ready-to-use AAV2 particles produced from pAAV-CaMKIIa-hM4D(Gi)-mCherry (#50477). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hM4D(Gi)-mCherry plasmid DNA.
CaMKIIa-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal silencing. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV2
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene mCherry
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV5 (Catalog # 50477-AAV5) ( Back to top)
Purpose
Ready-to-use AAV5 particles produced from pAAV-CaMKIIa-hM4D(Gi)-mCherry (#50477). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hM4D(Gi)-mCherry plasmid DNA.
CaMKIIa-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal silencing. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 3×10¹² vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV5
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene mCherry
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Data submitted about 50477-AAV5 by requesting scientist(s):
Information for AAV8 (Catalog # 50477-AAV8) ( Back to top)
Purpose
Ready-to-use AAV8 particles produced from pAAV-CaMKIIa-hM4D(Gi)-mCherry (#50477). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hM4D(Gi)-mCherry plasmid DNA.
CaMKIIa-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal silencing. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 2×10¹² vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV8
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene mCherry
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Data submitted about 50477-AAV8 by requesting scientist(s):
Information for AAV9 (Catalog # 50477-AAV9) ( Back to top)
Purpose
Ready-to-use AAV9 particles produced from pAAV-CaMKIIa-hM4D(Gi)-mCherry (#50477). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hM4D(Gi)-mCherry plasmid DNA.
CaMKIIa-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal silencing. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV9
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene mCherry
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CaMKIIa-hM4D(Gi)-mCherry was a gift from Bryan Roth (Addgene plasmid # 50477 ; http://n2t.net/addgene:50477 ; RRID:Addgene_50477) For viral preps, please replace (Addgene plasmid # 50477) in the above sentence with: (Addgene viral prep # 50477-AAV2), (Addgene viral prep # 50477-AAV5), (Addgene viral prep # 50477-AAV8), or (Addgene viral prep # 50477-AAV9)