-
PurposeExpression of Cre recombinase under the control of the UAS-promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50797 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUAS-luc2
-
Backbone manufacturerLiqun Luo
- Backbone size w/o insert (bp) 2959
- Total vector size (bp) 4036
-
Vector typeMulti-species
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre recombinase
-
Alt nameCre
-
Insert Size (bp)1077
- Promoter UAS-hsp70
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site XbaI (destroyed during cloning)
- 5′ sequencing primer AGCAAATAAACAAGCGCAGC
- 3′ sequencing primer GCATTCTAGTTGTGGTTTGTCC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUAS-Cre was a gift from Connie Cepko (Addgene plasmid # 50797 ; http://n2t.net/addgene:50797 ; RRID:Addgene_50797) -
For your References section:
A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Tang JC, Szikra T, Kozorovitskiy Y, Teixiera M, Sabatini BL, Roska B, Cepko CL. Cell. 2013 Aug 15;154(4):928-39. doi: 10.1016/j.cell.2013.07.021. 10.1016/j.cell.2013.07.021 PubMed 23953120