-
PurposeCo-expresses HA tagged channelrhodopsin and hM4D from a Cre-dependent virus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52521 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV2
- Backbone size w/o insert (bp) 5340
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStbl2 E coli from Invitrogen Grow at 30 degrees in 2xYT media
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameChR2-2a-hM4D
-
Alt nameChannelrhodopsin-2 H134R
-
Alt namemuscarinic receptor 4, variant
-
SpeciesH. sapiens (human); Chlamydomonas reinhardtii
-
Insert Size (bp)2940
-
Tag
/ Fusion Protein
- 2xHA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (destroyed during cloning)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer ggttcggcttctggcgtgtgacc
- 3′ sequencing primer CATAAAGAGACAGCAACCAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBryan Roth, UNC
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C.
Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.
Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed. The expected patterns can be calculated from the attached sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CAG::FLEX-rev:: ChR2HA-2a-hM4D was a gift from Scott Sternson (Addgene plasmid # 52521 ; http://n2t.net/addgene:52521 ; RRID:Addgene_52521) -
For your References section:
Chemogenetic synaptic silencing of neural circuits localizes a hypothalamus-->midbrain pathway for feeding behavior. Stachniak TJ, Ghosh A, Sternson SM. Neuron. 2014 May 21;82(4):797-808. doi: 10.1016/j.neuron.2014.04.008. Epub 2014 Apr 24. 10.1016/j.neuron.2014.04.008 PubMed 24768300