-
PurposeTarget a DHFR-destabilized Cre recombinase gene to the stop codon of the mouse Rasgrf2 gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61573 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBS SK2+
- Backbone size w/o insert (bp) 2917
- Total vector size (bp) 18191
-
Modifications to backboneMCS region was modified
-
Vector typeMouse Targeting, Cre/Lox
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl2
-
Growth instructionsGrow in 15 micog/ml kanamycin
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRasgrf2-2A-dCre
-
Alt nameDHFR-Cre
-
SpeciesM. musculus (mouse); P1 bacteriophage
-
Insert Size (bp)15274
-
Entrez GeneRasgrf2 (a.k.a. 6330417G04Rik, AW048350, Grf2, Ras-GRF2)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCTTCGCTATTACGCCAGCT
- 3′ sequencing primer AACAGCTATGACCATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Rasgrf2-2A-dCre targeting vector was a gift from Hongkui Zeng (Addgene plasmid # 61573 ; http://n2t.net/addgene:61573 ; RRID:Addgene_61573) -
For your References section:
Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Madisen L, Garner AR, Shimaoka D, Chuong AS, Klapoetke NC, Li L, van der Bourg A, Niino Y, Egolf L, Monetti C, Gu H, Mills M, Cheng A, Tasic B, Nguyen TN, Sunkin SM, Benucci A, Nagy A, Miyawaki A, Helmchen F, Empson RM, Knopfel T, Boyden ES, Reid RC, Carandini M, Zeng H. Neuron. 2015 Mar 4;85(5):942-58. doi: 10.1016/j.neuron.2015.02.022. 10.1016/j.neuron.2015.02.022 PubMed 25741722