pTC-CMV-Tet
(Plasmid
#85577)
-
PurposeSleeping beauty transposon for hydrodynamic tail vein injection for CreER expression and tetracyclin-dependent transgene/shRNA expression (CMV promoter) in mouse liver
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepT3
- Backbone size w/o insert (bp) 3392
- Total vector size (bp) 10647
-
Vector typeMammalian Expression, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCreER
-
Insert Size (bp)1985
- Promoter ApoE.HCR.hAAT
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (unknown if destroyed)
- 3′ cloning site MluI (unknown if destroyed)
- 5′ sequencing primer seq intron fwd (TCTCCACAGGTGTCCACTCC) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCreER sequence originally from addgene plasmid #12168
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTC-CMV-Tet was a gift from Ursula Ehmer (Addgene plasmid # 85577 ; http://n2t.net/addgene:85577 ; RRID:Addgene_85577) -
For your References section:
An in vivo transfection system for inducible gene expression and gene silencing in murine hepatocytes. Hubner EK, Lechler C, Kohnke-Ertel B, Zmoos AF, Sage J, Schmid RM, Ehmer U. J Gene Med. 2016 Dec 23. doi: 10.1002/jgm.2940. 10.1002/jgm.2940 PubMed 28009940