pDule2-3-nitroTyrosine (5B)
(Plasmid
#85499)
-
PurposePlasmid for incorporating the non-canonical amino acid 3-nitroTyrosine with the Mj 3NY (5B) synthetase and cognate amber suppressing tRNA in Ecoli.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85499 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDule2
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6300
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
-
Alt name3NY (5B) synthetase
-
Alt name3-nitroY (5B) synthetase
-
Alt name3-nitroTyr (5B) synthetase
-
SpeciesMethanocaldococcus jannaschii
-
Insert Size (bp)921
-
MutationY32H H70C D158S I159A L162R
- Promoter lpp (constitutive)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGTCACTGCGTCTTTTACTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDule2-3-nitroTyrosine (5B) was a gift from Ryan Mehl (Addgene plasmid # 85499 ; http://n2t.net/addgene:85499 ; RRID:Addgene_85499) -
For your References section:
Structural basis of improved second-generation 3-nitro-tyrosine tRNA synthetases. Cooley RB, Feldman JL, Driggers CM, Bundy TA, Stokes AL, Karplus PA, Mehl RA. Biochemistry. 2014 Apr 1;53(12):1916-24. doi: 10.1021/bi5001239. Epub 2014 Mar 20. 10.1021/bi5001239 PubMed 24611875